helpdesk

woensdag, december 07, 2005

Biotechnologie: bacterie als medicijnfabriek

Vraag:
Hoe kunnen met behulp van bacteriën medicijnen worden geproduceerd?

Reactie (niveau = eind VWO):
Een heleboel informatie is onder andere te vinden op de volgende sites:
Hoe maak je medicijnen met behulp van bacteriën? Hiervoor is een stukje kennis van de genetica nodig. Het verhaal in een notendopje:

Ten eerste moeten we weten wat we de bacterie willen laten produceren. Bijna alle medicijnen bestaan uit moleculen, eiwitten, die al van nature door een organisme gemaakt worden (bijv. penicilline door bepaalde schimmels). Van deze natuurlijke eiwitten kunnen we in het organisme het stukje DNA opzoeken dat voor dit eiwit codeert en dat stukje vervolgens gebruiken om het in te bouwen in eenvoudig te kweken bacteriën voor massaproductie.

Eiwitten zijn opgebouwd uit aminozuren. Er bestaan 20 verschillende aminozuren (zie ook: http://www.natuurlijkerwijs.com/aminozuren.htm). Het DNA is opgebouwd uit nucleotiden of basen. Er bestaan 4 verschillende nucleotiden:
Guanine, Cytosine, Adenine en Thymine (afgekort als G, C, A en T, zie ook: http://www.digischool.nl/bioplek/4ath/4ath(B1)_stw2_dna.html).

In het DNA staat de code voor eiwitten, doordat de nucleotiden per 3-tal (triplet of codon) een aminozuur voorstellen. Van het DNA wordt een enkelstrengs kopie gemaakt, het mRNA, waarbij in plaats van de T een U komt te staan. Het mRNA wordt in de ribosomen weer via tRNA vertaalt naar amonizuren en dus naar eiwitten.
In theorie kun je met 4 letters 64 combinaties van 3 maken (4x4x4). Dit betekent dat er meerdere codes mogelijk zijn voor een bepaald aminozuur, bijv. UUA, UUG, CUU, CUC, CUA en CUG coderen allemaal voor leucine. Naast de 20 aminozuren zijn er ook nog 4 codes die een speciale betekenis hebben:
  • AUG staat voor het aminozuur methionine of voor Start: het is altijd het eerste codon van een eiwit, daar waar de code start. Dit codon wordt daarom ook wel het Start-codon genoemd.
  • UAA, UAG en UGA zijn stop-codons. Als een eiwit gemaakt wordt en er komt een van deze drie codons langs, dan houdt de aanmaak daar op. Het is het einde van de code.
In onderstaand voorbeeld zijn dus 2 volledige stukjes eiwit gecodeerd, eentje van 7 codons (incl. start en stop-codon) en eentje van 5 codons.
AAGUGCCAUGUCGAGUCCGUUCGGUUAACUAGCUAUGAAGUACCAGUGACAUG

Nu zijn er twee technieken van belang als je precies wilt weten welk stukje DNA je nodig hebt en dit stukje vervolgens wilt overzetten in een bacterie:
Als je dus weet welk eiwit je zoekt, maar je weet niet welk gen van het organisme er voor heeft gecodeerd (vanwege al die dubbele mogelijkheden), kun je bepalen wat de verschillende mogelijke codes voor het eiwit zijn. Omdat je weet uit welke aminozuren het eiwit is opgebouwd kun je voorspellen welke mogelijkheden er zijn. Je hebt dan een lange lijst van mogelijke genen waarnaar je op zoek moet.

Als je weet welke mogelijke codes je zoekt, kun je door DNA Sequencing bepalen waar in het DNA van het organisme zich welke exacte code bevindt (een soort woordzoeker puzzel). Als het goed is zul je maar 1 van je mogelijke codes uit het lijstje werkelijk in het DNA terugvinden, tenzij het gen meerdere keren in het DNA voorkomt (wat voor dit soort eiwitten niet vaak voorkomt).

Als je weet wat de exacte code is en wat er in het DNA aan code aan vooraf gaat en erop volgt, kun je het DNA op specifiek die plaats losknippen en zo het stukje isoleren. Hiervoor zijn restrictie enzymen nodig, die op het juiste punt het DNA losknippen en zorgen dat alleen van dat stukje een kopie wordt gemaakt. Hoe dit in zijn werk gaat is te moeilijk om hier te beschrijven (ter vergelijk: ik heb hier een boek over genetica dat ik bij mijn studie gebruikte en daar wordt het in 40 pagina's uitgelegd).

Als je het losse stukje DNA hebt, kun je dit via PCR vermeerderen, zodat je een heleboel stukjes DNA hebt. Als we het gen gaan inbouwen bij bacteriën dan plakken we er meteen ook een bepaalde antibiotica resistentie aan vast. Bovendien krijgen de stukjes een uniek herkenbaar stukje, dat past bij een bepaald restrictie enzym.

Nu komen we bij de bacterie, die naast zijn gewone DNA ook Plasmide-DNA heeft. Bacteriën wisselen zelf vaak Plasmide-DNA uit, waardoor ze zich sneller kunnen aanpassen aan hun omgeving dan wanneer ze enkel via reproductie hun genen kunt doorgeven. Daarvoor gebruiken zij restrictie enzymen. Deze enzymen worden ook gebruikt om een stukje DNA in te bouwen in de bestaande DNA structuur bij de Recombinant DNA technieken.

Met behulp van een restrictie enzym wordt het plasmide DNA van de bacterie opengeknipt. De losse uiteinden bevatten nu code die precies past bij de uiteinden van het in te bouwen stukje, dat bewust dat passende uiteinde heeft gekregen. Door de plasmiden, het restrictie enzym en de nieuwe stukjes DNA bij elkaar in een oplossing te brengen, ontstaan er dus zeker wel een aantal nieuwe plasmiden waarin het stukje is ingebouwd. Maar niet in alle plasmiden gebeurt dit, dat hangt af van het toeval.

Door deze plasmiden weer in een voedingsbodem aan te bieden aan bacteriën, kunnen zij de plasmiden in zich opnemen. Nu komt de antibioticum resistentie van pas die in het nieuwe stukje was ingebouwd. Door de bacteriën over te zetten op een voedingsbodem met het betreffende antibioticum erin, zullen alleen dee bacteriën overleven die het nieuwe stukje DNA goed hebben ingebouwd. Deze bacteriën kun je nu eenvoudig isoleren en verder opkweken. En via chemische toevoegingen kun je de transcriptie van het nieuwe DNA naar de gewenste eiwitten aanzetten, waardoor de bacterie het medicijn gaat produceren.

Voordelen spreken natuurlijk voor zich:
  • Bacteriën kun je heel gemakkelijk in grote aantallen kweken, dus kun je veel medicijn produceren. Er zijn minder ethische bewaren dan bij transgene dieren, zoals stier Herman.
  • Omdat je alleen de code voor het medicijn in de bacterie inbouwt en niet het omringende originele DNA, weet je zeker dat je een puur medicijn geproduceerd krijgt.
  • Indien een medicijn schadelijk is voor bacteriën, kun je het medicijn toch in 2 delen laten produceren door bacteriën en kun je deze delen later buiten de bacterie alsnog aan elkaar maken.
Behalve productie door bacteriën, kun je ook kiezen voor een andere gentechnologie.
Zo kan je bijvoorbeeld via deze gerecombineerde bacterie, of via een op vergelijkbare wijze gemaakt virus, ook een ander organisme "besmetten" met nieuw DNA. Hierdoor gaat dit organisme het nieuwe stukje DNA in zijn genen inbouwen, waarmee bijvoorbeeld bepaalde genetische afwijkingen te genezen zijn.

Of je kan het stukje DNA zelfs gewoon rechstreeks in een bevruchte cel injecteren waardoor alle cellen van het organisme later dat gen bevatten en ook alle nakomelingen van dat organisme. Hiermee worden transgene dieren gemaakt, zoals bijvoorbeeld stier Herman. Al zijn nakomelingen zullen een extra gen hebben dat codeert voor een eiwit (lactoferrine) dat in de melk van de koeien terecht komt. Dit eiwit zou weer gebruikt kunnen worden in medicijnen voor mensen.

Het voordeel van transgene dieren is dat je de productie beter onder controle kunt houden: de koe regelt zelf wel dat de eiwitten gemaakt worden, terwijl je bij bacteriën of weefselkweek in het lab alle juiste omstandigheden moet nabootsen.
Maar het manipuleren van dieren ligt veel gevoeliger, kent soms ook risico's voor het welzijn van de dieren. En daarom is medicijnproductie via bacteriën een vorm van zogenaamde "Witte biotechnologie": een duurzame biologische toepassing in de industrie.

Meer informatie kun je vinden door op internet te zoeken naar de volgende begrippen en combinaties van deze begrippen:
  • Recombinant DNA
  • Restrictie enzym
  • Aminozuren, eiwitsynthese
  • Gentechnologie, duurzame biotechnologie
  • Genen isoleren
  • Plasmiden
  • Nucleotiden
  • Transgeen, transgene organismen
  • etc. etc.

Geen opmerkingen: